PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)NAMEperlretut - Perl regular expressions tutorial
DESCRIPTION
This page provides a basic tutorial on understanding, cre
ating and using regular expressions in Perl. It serves as
a complement to the reference page on regular expressions
the perlre manpage. Regular expressions are an integral
part of the "m//", "s///", "qr//" and "split" operators
and so this tutorial also overlaps with the Regexp Quote-
Like Operators entry in the perlop manpage and the split
entry in the perlfunc manpage.
Perl is widely renowned for excellence in text processing,
and regular expressions are one of the big factors behind
this fame. Perl regular expressions display an efficiency
and flexibility unknown in most other computer languages.
Mastering even the basics of regular expressions will
allow you to manipulate text with surprising ease.
What is a regular expression? A regular expression is
simply a string that describes a pattern. Patterns are in
common use these days; examples are the patterns typed
into a search engine to find web pages and the patterns
used to list files in a directory, e.g., "ls *.txt" or
"dir *.*". In Perl, the patterns described by regular
expressions are used to search strings, extract desired
parts of strings, and to do search and replace operations.
Regular expressions have the undeserved reputation of
being abstract and difficult to understand. Regular
expressions are constructed using simple concepts like
conditionals and loops and are no more difficult to under
stand than the corresponding "if" conditionals and "while"
loops in the Perl language itself. In fact, the main
challenge in learning regular expressions is just getting
used to the terse notation used to express these concepts.
This tutorial flattens the learning curve by discussing
regular expression concepts, along with their notation,
one at a time and with many examples. The first part of
the tutorial will progress from the simplest word searches
to the basic regular expression concepts. If you master
the first part, you will have all the tools needed to
solve about 98% of your needs. The second part of the
tutorial is for those comfortable with the basics and hun
gry for more power tools. It discusses the more advanced
regular expression operators and introduces the latest
cutting edge innovations in 5.6.0.
A note: to save time, 'regular expression' is often abbre
viated as regexp or regex. Regexp is a more natural
abbreviation than regex, but is harder to pronounce. The
Perl pod documentation is evenly split on regexp vs regex;
in Perl, there is more than one way to abbreviate it.
We'll use regexp in this tutorial.
Part 1: The basics
Simple word matching
The simplest regexp is simply a word, or more generally, a
string of characters. A regexp consisting of a word
matches any string that contains that word:
"Hello World" =~ /World/; # matches
What is this perl statement all about? ""Hello World"" is
a simple double quoted string. "World" is the regular
expression and the "//" enclosing "/World/" tells perl to
search a string for a match. The operator "=~" associates
the string with the regexp match and produces a true value
if the regexp matched, or false if the regexp did not
match. In our case, "World" matches the second word in
""Hello World"", so the expression is true. Expressions
like this are useful in conditionals:
if ("Hello World" =~ /World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
There are useful variations on this theme. The sense of
the match can be reversed by using "!~" operator:
if ("Hello World" !~ /World/) {
print "It doesn't match\n";
}
else {
print "It matches\n";
}
The literal string in the regexp can be replaced by a
variable:
$greeting = "World";
if ("Hello World" =~ /$greeting/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
If you're matching against the special default variable
"$_", the "$_ =~" part can be omitted:
$_ = "Hello World";
if (/World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
And finally, the "//" default delimiters for a match can
be changed to arbitrary delimiters by putting an "'m'" out
front:
"Hello World" =~ m!World!; # matches, delimited by '!'
"Hello World" =~ m{World}; # matches, note the matching '{}'
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
# '/' becomes an ordinary char
"/World/", "m!World!", and "m{World}" all represent the
same thing. When, e.g., """" is used as a delimiter, the
forward slash "'/'" becomes an ordinary character and can
be used in a regexp without trouble.
Let's consider how different regexps would match ""Hello
World"":
"Hello World" =~ /world/; # doesn't match
"Hello World" =~ /o W/; # matches
"Hello World" =~ /oW/; # doesn't match
"Hello World" =~ /World /; # doesn't match
The first regexp "world" doesn't match because regexps are
case-sensitive. The second regexp matches because the
substring "'o W'" occurs in the string ""Hello World"" .
The space character ' ' is treated like any other charac
ter in a regexp and is needed to match in this case. The
lack of a space character is the reason the third regexp
"'oW'" doesn't match. The fourth regexp "'World '"
doesn't match because there is a space at the end of the
regexp, but not at the end of the string. The lesson here
is that regexps must match a part of the string exactly in
order for the statement to be true.
If a regexp matches in more than one place in the string,
perl will always match at the earliest possible point in
the string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
"That hat is red" =~ /hat/; # matches 'hat' in 'That'
With respect to character matching, there are a few more
points you need to know about. First of all, not all
characters can be used 'as is' in a match. Some charac
ters, called metacharacters, are reserved for use in reg
exp notation. The metacharacters are
{}[]()^$.|*+?\
The significance of each of these will be explained in the
rest of the tutorial, but for now, it is important only to
know that a metacharacter can be matched by putting a
backslash before it:
"2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
"/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
In the last regexp, the forward slash "'/'" is also back
slashed, because it is used to delimit the regexp. This
can lead to LTS (leaning toothpick syndrome), however, and
it is often more readable to change delimiters.
The backslash character "'\'" is a metacharacter itself
and needs to be backslashed:
'C:\WIN32' =~ /C:\\WIN/; # matches
In addition to the metacharacters, there are some ASCII
characters which don't have printable character equiva
lents and are instead represented by escape sequences.
Common examples are "\t" for a tab, "\n" for a newline,
"\r" for a carriage return and "\a" for a bell. If your
string is better thought of as a sequence of arbitrary
bytes, the octal escape sequence, e.g., "\033", or hex
adecimal escape sequence, e.g., "\x1B" may be a more natu
ral representation for your bytes. Here are some examples
of escapes:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
"cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
If you've been around Perl a while, all this talk of
escape sequences may seem familiar. Similar escape
sequences are used in double-quoted strings and in fact
the regexps in Perl are mostly treated as double-quoted
strings. This means that variables can be used in regexps
as well. Just like double-quoted strings, the values of
the variables in the regexp will be substituted in before
the regexp is evaluated for matching purposes. So we
have:
$foo = 'house';
'housecat' =~ /$foo/; # matches
'cathouse' =~ /cat$foo/; # matches
'housecat' =~ /${foo}cat/; # matches
So far, so good. With the knowledge above you can already
perform searches with just about any literal string regexp
you can dream up. Here is a very simple emulation of the
Unix grep program:
% cat > simple_grep
#!/usr/bin/perl
$regexp = shift;
while (<>) {
print if /$regexp/;
}
^D
% chmod +x simple_grep
% simple_grep abba /usr/dict/words
Babbage
cabbage
cabbages
sabbath
Sabbathize
Sabbathizes
sabbatical
scabbard
scabbards
This program is easy to understand. "#!/usr/bin/perl" is
the standard way to invoke a perl program from the shell.
"$regexp = shift;" saves the first command line argument
as the regexp to be used, leaving the rest of the command
line arguments to be treated as files. "while (<>)"
loops over all the lines in all the files. For each line,
"print if /$regexp/;" prints the line if the regexp
matches the line. In this line, both "print" and "/$reg
exp/" use the default variable "$_" implicitly.
With all of the regexps above, if the regexp matched any
where in the string, it was considered a match. Some
times, however, we'd like to specify where in the string
the regexp should try to match. To do this, we would use
the anchor metacharacters "^" and "$". The anchor "^"
means match at the beginning of the string and the anchor
"$" means match at the end of the string, or before a new
line at the end of the string. Here is how they are used:
"housekeeper" =~ /keeper/; # matches
"housekeeper" =~ /^keeper/; # doesn't match
"housekeeper" =~ /keeper$/; # matches
"housekeeper\n" =~ /keeper$/; # matches
The second regexp doesn't match because "^" constrains
"keeper" to match only at the beginning of the string, but
""housekeeper"" has keeper starting in the middle. The
third regexp does match, since the "$" constrains "keeper"
to match only at the end of the string.
When both "^" and "$" are used at the same time, the reg
exp has to match both the beginning and the end of the
string, i.e., the regexp matches the whole string. Con
sider
"keeper" =~ /^keep$/; # doesn't match
"keeper" =~ /^keeper$/; # matches
"" =~ /^$/; # ^$ matches an empty string
The first regexp doesn't match because the string has more
to it than "keep". Since the second regexp is exactly the
string, it matches. Using both "^" and "$" in a regexp
forces the complete string to match, so it gives you com
plete control over which strings match and which don't.
Suppose you are looking for a fellow named bert, off in a
string by himself:
"dogbert" =~ /bert/; # matches, but not what you want
"dilbert" =~ /^bert/; # doesn't match, but ..
"bertram" =~ /^bert/; # matches, so still not good enough
"bertram" =~ /^bert$/; # doesn't match, good
"dilbert" =~ /^bert$/; # doesn't match, good
"bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just
as easily use the string equivalence "$string eq 'bert'"
and it would be more efficient. The "^...$" regexp
really becomes useful when we add in the more powerful
regexp tools below.
Using character classes
Although one can already do quite a lot with the literal
string regexps above, we've only scratched the surface of
regular expression technology. In this and subsequent
sections we will introduce regexp concepts (and associated
metacharacter notations) that will allow a regexp to not
just represent a single character sequence, but a whole
class of them.
One such concept is that of a character class. A charac
ter class allows a set of possible characters, rather than
just a single character, to match at a particular point in
a regexp. Character classes are denoted by brackets
"[...]", with the set of characters to be possibly matched
inside. Here are some examples:
/cat/; # matches 'cat'
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
/item[0123456789]/; # matches 'item0' or ... or 'item9'
"abc" =~ /[cab]/; # matches 'a'
In the last statement, even though "'c'" is the first
character in the class, "'a'" matches because the first
character position in the string is the earliest point at
which the regexp can match.
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
This regexp displays a common task: perform a a case-
insensitive match. Perl provides away of avoiding all
those brackets by simply appending an "'i'" to the end of
the match. Then "/[yY][eE][sS]/;" can be rewritten as
"/yes/i;". The "'i'" stands for case-insensitive and is
an example of a modifier of the matching operation. We
will meet other modifiers later in the tutorial.
We saw in the section above that there were ordinary char
acters, which represented themselves, and special charac
ters, which needed a backslash "\" to represent them
selves. The same is true in a character class, but the
sets of ordinary and special characters inside a character
class are different than those outside a character class.
The special characters for a character class are "-]\^$".
"]" is special because it denotes the end of a character
class. "$" is special because it denotes a scalar vari
able. "\" is special because it is used in escape
sequences, just like above. Here is how the special char
acters "]$\" are handled:
/[\]c]def/; # matches ']def' or 'cdef'
$x = 'bcr';
/[$x]at/; # matches 'bat', 'cat', or 'rat'
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
The last two are a little tricky. in "[\$x]", the back
slash protects the dollar sign, so the character class has
two members "$" and "x". In "[\\$x]", the backslash is
protected, so "$x" is treated as a variable and substi
tuted in double quote fashion.
The special character "'-'" acts as a range operator
within character classes, so that a contiguous set of
characters can be written as a range. With ranges, the
unwieldy "[0123456789]" and "[abc...xyz]" become the
svelte "[0-9]" and "[a-z]". Some examples are
/item[0-9]/; # matches 'item0' or ... or 'item9'
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
/[0-9a-zA-Z_]/; # matches a "word" character,
# like those in a perl variable name
If "'-'" is the first or last character in a character
class, it is treated as an ordinary character; "[-ab]",
"[ab-]" and "[a\-b]" are all equivalent.
The special character "^" in the first position of a char
acter class denotes a negated character class, which
matches any character but those in the brackets. Both
"[...]" and "[^...]" must match a character, or the match
fails. Then
/[^a]at/; # doesn't match 'aat' or 'at', but matches
# all other 'bat', 'cat, '0at', '%at', etc.
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
Now, even "[0-9]" can be a bother the write multiple
times, so in the interest of saving keystrokes and making
regexps more readable, Perl has several abbreviations for
common character classes:
\d is a digit and represents [0-9]
\s is a whitespace character and represents [\
\t\r\n\f]
\w is a word character (alphanumeric or _) and repre
sents [0-9a-zA-Z_]
\D is a negated \d; it represents any character but a
digit [^0-9]
\S is a negated \s; it represents any non-whitespace
character [^\s]
\W is a negated \w; it represents any non-word charac
ter [^\w]
The period '.' matches any character but "\n"
The "\d\s\w\D\S\W" abbreviations can be used both inside
and outside of character classes. Here are some in use:
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
/\w\W\w/; # matches a word char, followed by a
# non-word char, followed by a word char
/..rt/; # matches any two chars, followed by 'rt'
/end\./; # matches 'end.'
/end[.]/; # same thing, matches 'end.'
Because a period is a metacharacter, it needs to be
escaped to match as an ordinary period. Because, for exam
ple, "\d" and "\w" are sets of characters, it is incorrect
to think of "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is
the same as "[^\w]", which is the same as "[\W]". Think
DeMorgan's laws.
An anchor useful in basic regexps is the word anchor
"\b". This matches a boundary between a word character
and a non-word character "\w\W" or "\W\w":
$x = "Housecat catenates house and cat";
$x =~ /cat/; # matches cat in 'housecat'
$x =~ /\bcat/; # matches cat in 'catenates'
$x =~ /cat\b/; # matches cat in 'housecat'
$x =~ /\bcat\b/; # matches 'cat' at end of string
Note in the last example, the end of the string is consid
ered a word boundary.
You might wonder why "'.'" matches everything but ""\n"" -
why not every character? The reason is that often one is
matching against lines and would like to ignore the
newline characters. For instance, while the string ""\n""
represents one line, we would like to think of as empty.
Then
"" =~ /^$/; # matches
"\n" =~ /^$/; # matches, "\n" is ignored
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
"a\n" =~ /^.$/; # matches, ignores the "\n"
This behavior is convenient, because we usually want to
ignore newlines when we count and match characters in a
line. Sometimes, however, we want to keep track of new
lines. We might even want "^" and "$" to anchor at the
beginning and end of lines within the string, rather than
just the beginning and end of the string. Perl allows us
to choose between ignoring and paying attention to new
lines by using the "//s" and "//m" modifiers. "//s" and
"//m" stand for single line and multi-line and they deter
mine whether a string is to be treated as one continuous
string, or as a set of lines. The two modifiers affect
two aspects of how the regexp is interpreted: 1) how the
"'.'" character class is defined, and 2) where the anchors
"^" and "$" are able to match. Here are the four possible
combinations:
no modifiers (//): Default behavior. "'.'" matches
any character except ""\n"". "^" matches only at the
beginning of the string and "$" matches only at the
end or before a newline at the end.
s modifier (//s): Treat string as a single long line.
"'.'" matches any character, even ""\n"". "^" matches
only at the beginning of the string and "$" matches
only at the end or before a newline at the end.
m modifier (//m): Treat string as a set of multiple
lines. "'.'" matches any character except ""\n"".
"^" and "$" are able to match at the start or end of
any line within the string.
both s and m modifiers (//sm): Treat string as a sin
gle long line, but detect multiple lines. "'.'"
matches any character, even ""\n"". "^" and "$", how
ever, are able to match at the start or end of any
line within the string.
Here are examples of "//s" and "//m" in action:
$x = "There once was a girl\nWho programmed in Perl\n";
$x =~ /^Who/; # doesn't match, "Who" not at start of string
$x =~ /^Who/s; # doesn't match, "Who" not at start of string
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /^Who/sm; # matches, "Who" at start of second line
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/s; # matches, "." matches "\n"
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"
Most of the time, the default behavior is what is want,
but "//s" and "//m" are occasionally very useful. If
"//m" is being used, the start of the string can still be
matched with "\A" and the end of string can still be
matched with the anchors "\Z" (matches both the end and
the newline before, like "$"), and "\z" (matches only the
end):
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
$x =~ /girl$/m; # matches, "girl" at end of first line
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
We now know how to create choices among classes of charac
ters in a regexp. What about choices among words or char
acter strings? Such choices are described in the next sec
tion.
Matching this or that
Sometimes we would like to our regexp to be able to match
different possible words or character strings. This is
accomplished by using the alternation metacharacter "|".
To match "dog" or "cat", we form the regexp "dog|cat". As
before, perl will try to match the regexp at the earliest
possible point in the string. At each character position,
perl will first try to match the first alternative, "dog".
If "dog" doesn't match, perl will then try the next alter
native, "cat". If "cat" doesn't match either, then the
match fails and perl moves to the next position in the
string. Some examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"
Even though "dog" is the first alternative in the second
regexp, "cat" is able to match earlier in the string.
"cats" =~ /c|ca|cat|cats/; # matches "c"
"cats" =~ /cats|cat|ca|c/; # matches "cats"
Here, all the alternatives match at the first string posi
tion, so the first alternative is the one that matches.
If some of the alternatives are truncations of the others,
put the longest ones first to give them a chance to match.
"cab" =~ /a|b|c/ # matches "c"
# /a|b|c/ == /[abc]/
The last example points out that character classes are
like alternations of characters. At a given character
position, the first alternative that allows the regexp
match to succeed wil be the one that matches.
Grouping things and hierarchical matching
Alternation allows a regexp to choose among alternatives,
but by itself it unsatisfying. The reason is that each
alternative is a whole regexp, but sometime we want alter
natives for just part of a regexp. For instance, suppose
we want to search for housecats or housekeepers. The reg
exp "housecat|housekeeper" fits the bill, but is ineffi
cient because we had to type "house" twice. It would be
nice to have parts of the regexp be constant, like
"house", and and some parts have alternatives, like
"cat|keeper".
The grouping metacharacters "()" solve this problem.
Grouping allows parts of a regexp to be treated as a sin
gle unit. Parts of a regexp are grouped by enclosing them
in parentheses. Thus we could solve the "housecat|house
keeper" by forming the regexp as "house(cat|keeper)". The
regexp "house(cat|keeper)" means match "house" followed by
either "cat" or "keeper". Some more examples are
/(a|b)b/; # matches 'ab' or 'bb'
/(ac|b)b/; # matches 'acb' or 'bb'
/(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
/house(cat|)/; # matches either 'housecat' or 'house'
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
# 'house'. Note groups can be nested.
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
# because '20\d\d' can't match
Alternations behave the same way in groups as out of them:
at a given string position, the leftmost alternative that
allows the regexp to match is taken. So in the last exam
ple at tth first string position, ""20"" matches the sec
ond alternative, but there is nothing left over to match
the next two digits "\d\d". So perl moves on to the next
alternative, which is the null alternative and that works,
since ""20"" is two digits.
The process of trying one alternative, seeing if it
matches, and moving on to the next alternative if it
doesn't, is called backtracking. The term 'backtracking'
comes from the idea that matching a regexp is like a walk
in the woods. Successfully matching a regexp is like
arriving at a destination. There are many possible trail
heads, one for each string position, and each one is tried
in order, left to right. From each trailhead there may be
many paths, some of which get you there, and some which
are dead ends. When you walk along a trail and hit a dead
end, you have to backtrack along the trail to an earlier
point to try another trail. If you hit your destination,
you stop immediately and forget about trying all the other
trails. You are persistent, and only if you have tried
all the trails from all the trailheads and not arrived at
your destination, do you declare failure. To be concrete,
here is a step-by-step analysis of what perl does when it
tries to match the regexp
"abcde" =~ /(abd|abc)(df|d|de)/;
0 Start with the first letter in the string 'a'.
1 Try the first alternative in the first group 'abd'.
2 Match 'a' followed by 'b'. So far so good.
3 'd' in the regexp doesn't match 'c' in the string - a
dead end. So backtrack two characters and pick the
second alternative in the first group 'abc'.
4 Match 'a' followed by 'b' followed by 'c'. We are on
a roll and have satisfied the first group. Set $1 to
'abc'.
5 Move on to the second group and pick the first alter
native 'df'.
6 Match the 'd'.
7 'f' in the regexp doesn't match 'e' in the string, so
a dead end. Backtrack one character and pick the sec
ond alternative in the second group 'd'.
8 'd' matches. The second grouping is satisfied, so set
$2 to 'd'.
9 We are at the end of the regexp, so we are done! We
have matched 'abcd' out of the string "abcde".
There are a couple of things to note about this analysis.
First, the third alternative in the second group 'de' also
allows a match, but we stopped before we got to it - at a
given character position, leftmost wins. Second, we were
able to get a match at the first character position of the
string 'a'. If there were no matches at the first posi
tion, perl would move to the second character position 'b'
and attempt the match all over again. Only when all pos
sible paths at all possible character positions have been
exhausted does perl give give up and declare
"$string =~ /(abd|abc)(df|d|de)/;" to be false.
Even with all this work, regexp matching happens remark
ably fast. To speed things up, during compilation stage,
perl compiles the regexp into a compact sequence of
opcodes that can often fit inside a processor cache. When
the code is executed, these opcodes can then run at full
throttle and search very quickly.
Extracting matches
The grouping metacharacters "()" also serve another com
pletely different function: they allow the extraction of
the parts of a string that matched. This is very useful
to find out what matched and for text processing in gen
eral. For each grouping, the part that matched inside
goes into the special variables "$1", "$2", etc. They can
be used just as ordinary variables:
# extract hours, minutes, seconds
$time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
$hours = $1;
$minutes = $2;
$seconds = $3;
Now, we know that in scalar context,
"$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false
value. In list context, however, it returns the list of
matched values "($1,$2,$3)". So we could write the code
more compactly as
# extract hours, minutes, seconds
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
If the groupings in a regexp are nested, "$1" gets the
group with the leftmost opening parenthesis, "$2" the next
opening parenthesis, etc. For example, here is a complex
regexp and the matching variables indicated below it:
/(ab(cd|ef)((gi)|j))/;
1 2 34
so that if the regexp matched, e.g., "$2" would contain
'cd' or 'ef'. For convenience, perl sets "$+" to the
highest numbered "$1", "$2", ... that got assigned.
Closely associated with the matching variables "$1", "$2",
... are the backreferences "\1", "\2", ... . Backrefer
ences are simply matching variables that can be used
inside a regexp. This is a really nice feature - what
matches later in a regexp can depend on what matched ear
lier in the regexp. Suppose we wanted to look for doubled
words in text, like 'the the'. The following regexp finds
all 3-letter doubles with a space in between:
/(\w\w\w)\s\1/;
The grouping assigns a value to \1, so that the same 3
letter sequence is used for both parts. Here are some
words with repeated parts:
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
beriberi
booboo
coco
mama
murmur
papa
The regexp has a single grouping which considers 4-letter
combinations, then 3-letter combinations, etc. and uses
"\1" to look for a repeat. Although "$1" and "\1" repre
sent the same thing, care should be taken to use matched
variables "$1", "$2", ... only outside a regexp and back
references "\1", "\2", ... only inside a regexp; not doing
so may lead to surprising and/or undefined results.
In addition to what was matched, Perl 5.6.0 also provides
the positions of what was matched with the "@-" and "@+"
arrays. "$-[0]" is the position of the start of the entire
match and "$+[0]" is the position of the end. Similarly,
"$-[n]" is the position of the start of the "$n" match and
"$+[n]" is the position of the end. If "$n" is undefined,
so are "$-[n]" and "$+[n]". Then this code
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
foreach $expr (1..$#-) {
print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
}
prints
Match 1: 'Mmm' at position (0,3)
Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still
possible to find out what exactly matched in a string. If
you use them, perl will set "$`" to the part of the string
before the match, will set "$&" to the part of the string
that matched, and will set "$'" to the part of the string
after the match. An example:
$x = "the cat caught the mouse";
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
In the second match, "$` = ''" because the regexp matched
at the first character position in the string and stopped,
it never saw the second 'the'. It is important to note
that using "$`" and "$'" slows down regexp matching quite
a bit, and " $& " slows it down to a lesser extent,
because if they are used in one regexp in a program, they
are generated for <all> regexps in the program. So if raw
performance is a goal of your application, they should be
avoided. If you need them, use "@-" and "@+" instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )
Matching repetitions
The examples in the previous section display an annoying
weakness. We were only matching 3-letter words, or sylla
bles of 4 letters or less. We'd like to be able to match
words or syllables of any length, without writing out
tedious alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".
This is exactly the problem the quantifier metacharacters
"?", "*", "+", and "{}" were created for. They allow us
to determine the number of repeats of a portion of a reg
exp we consider to be a match. Quantifiers are put imme
diately after the character, character class, or grouping
that we want to specify. They have the following mean
ings:
"a?" = match 'a' 1 or 0 times
"a*" = match 'a' 0 or more times, i.e., any number of
times
"a+" = match 'a' 1 or more times, i.e., at least once
"a{n,m}" = match at least "n" times, but not more than
"m" times.
"a{n,}" = match at least "n" or more times
"a{n}" = match exactly "n" times
Here are some examples:
/[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
# any number of digits
/(\w+)\s+\1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
$year =~ /\d{2,4}/; # make sure year is at least 2 but not more
# than 4 digits
$year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
$year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
# this produces $1 and the other does not.
% simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
mama
murmur
papa
For all of these quantifiers, perl will try to match as
much of the string as possible, while still allowing the
regexp to succeed. Thus with "/a?.../", perl will first
try to match the regexp with the "a" present; if that
fails, perl will try to match the regexp without the "a"
present. For the quantifier "*", we get the following:
$x = "the cat in the hat";
$x =~ /^(.*)(cat)(.*)$/; # matches,
# $1 = 'the '
# $2 = 'cat'
# $3 = ' in the hat'
Which is what we might expect, the match finds the only
"cat" in the string and locks onto it. Consider, however,
this regexp:
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)
One might initially guess that perl would find the "at" in
"cat" and stop there, but that wouldn't give the longest
possible string to the first quantifier ".*". Instead,
the first quantifier ".*" grabs as much of the string as
possible while still having the regexp match. In this
example, that means having the "at" sequence with the
final "at" in the string. The other important principle
illustrated here is that when there are two or more ele
ments in a regexp, the leftmost quantifier, if there is
one, gets to grab as much the string as possible, leaving
the rest of the regexp to fight over scraps. Thus in our
example, the first quantifier ".*" grabs most of the
string, while the second quantifier ".*" gets the empty
string. Quantifiers that grab as much of the string as
possible are called maximal match or greedy quantifiers.
When a regexp can match a string in several different
ways, we can use the principles above to predict which way
the regexp will match:
Principle 0: Taken as a whole, any regexp will be
matched at the earliest possible position in the
string.
Principle 1: In an alternation "a|b|c...", the left
most alternative that allows a match for the whole
regexp will be the one used.
Principle 2: The maximal matching quantifiers "?",
"*", "+" and "{n,m}" will in general match as much of
the string as possible while still allowing the whole
regexp to match.
Principle 3: If there are two or more elements in a
regexp, the leftmost greedy quantifier, if any, will
match as much of the string as possible while still
allowing the whole regexp to match. The next leftmost
greedy quantifier, if any, will try to match as much
of the string remaining available to it as possible,
while still allowing the whole regexp to match. And
so on, until all the regexp elements are satisfied.
As we have seen above, Principle 0 overrides the others -
the regexp will be matched as early as possible, with the
other principles determining how the regexp matches at
that earliest character position.
Here is an example of these principles in action:
$x = "The programming republic of Perl";
$x =~ /^(.+)(e|r)(.*)$/; # matches,
# $1 = 'The programming republic of Pe'
# $2 = 'r'
# $3 = 'l'
This regexp matches at the earliest string position,
"'T'". One might think that "e", being leftmost in the
alternation, would be matched, but "r" produces the
longest string in the first quantifier.
$x =~ /(m{1,2})(.*)$/; # matches,
# $1 = 'mm'
# $2 = 'ing republic of Perl'
Here, The earliest possible match is at the first "'m'" in
"programming". "m{1,2}" is the first quantifier, so it
gets to match a maximal "mm".
$x =~ /.*(m{1,2})(.*)$/; # matches,
# $1 = 'm'
# $2 = 'ing republic of Perl'
Here, the regexp matches at the start of the string. The
first quantifier ".*" grabs as much as possible, leaving
just a single "'m'" for the second quantifier "m{1,2}".
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Here, ".?" eats its maximal one character at the earliest
possible position in the string, "'a'" in "programming",
leaving "m{1,2}" the opportunity to match both "m"'s.
Finally,
"aXXXb" =~ /(X*)/; # matches with $1 = ''
because it can match zero copies of "'X'" at the beginning
of the string. If you definitely want to match at least
one "'X'", use "X+", not "X*".
Sometimes greed is not good. At times, we would like
quantifiers to match a minimal piece of string, rather
than a maximal piece. For this purpose, Larry Wall cre
ated the minimal match or non-greedy quantifiers
"??","*?", "+?", and "{}?". These are the usual quanti
fiers with a "?" appended to them. They have the follow
ing meanings:
"a??" = match 'a' 0 or 1 times. Try 0 first, then 1.
"a*?" = match 'a' 0 or more times, i.e., any number of
times, but as few times as possible
"a+?" = match 'a' 1 or more times, i.e., at least
once, but as few times as possible
"a{n,m}?" = match at least "n" times, not more than
"m" times, as few times as possible
"a{n,}?" = match at least "n" times, but as few times
as possible
"a{n}?" = match exactly "n" times. Because we match
exactly "n" times, "a{n}?" is equivalent to "a{n}" and
is just there for notational consistency.
Let's look at the example above, but with minimal quanti
fiers:
$x = "The programming republic of Perl";
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
# $1 = 'Th'
# $2 = 'e'
# $3 = ' programming republic of Perl'
The minimal string that will allow both the start of the
string "^" and the alternation to match is "Th", with the
alternation "e|r" matching "e". The second quantifier
".*" is free to gobble up the rest of the string.
$x =~ /(m{1,2}?)(.*?)$/; # matches,
# $1 = 'm'
# $2 = 'ming republic of Perl'
The first string position that this regexp can match is at
the first "'m'" in "programming". At this position, the
minimal "m{1,2}?" matches just one "'m'". Although the
second quantifier ".*?" would prefer to match no charac
ters, it is constrained by the end-of-string anchor "$" to
match the rest of the string.
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
# $1 = 'The progra'
# $2 = 'm'
# $3 = 'ming republic of Perl'
In this regexp, you might expect the first minimal quanti
fier ".*?" to match the empty string, because it is not
constrained by a "^" anchor to match the beginning of the
word. Principle 0 applies here, however. Because it is
possible for the whole regexp to match at the start of the
string, it will match at the start of the string. Thus
the first quantifier has to match everything up to the
first "m". The second minimal quantifier matches just one
"m" and the third quantifier matches the rest of the
string.
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Just as in the previous regexp, the first quantifier ".??"
can match earliest at position "'a'", so it does. The
second quantifier is greedy, so it matches "mm", and the
third matches the rest of the string.
We can modify principle 3 above to take into account non-
greedy quantifiers:
Principle 3: If there are two or more elements in a
regexp, the leftmost greedy (non-greedy) quantifier,
if any, will match as much (little) of the string as
possible while still allowing the whole regexp to
match. The next leftmost greedy (non-greedy) quanti
fier, if any, will try to match as much (little) of
the string remaining available to it as possible,
while still allowing the whole regexp to match. And
so on, until all the regexp elements are satisfied.
Just like alternation, quantifiers are also susceptible to
backtracking. Here is a step-by-step analysis of the
example
$x = "the cat in the hat";
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)
0 Start with the first letter in the string 't'.
1 The first quantifier '.*' starts out by matching the
whole string 'the cat in the hat'.
2 'a' in the regexp element 'at' doesn't match the end
of the string. Backtrack one character.
3 'a' in the regexp element 'at' still doesn't match the
last letter of the string 't', so backtrack one more
character.
4 Now we can match the 'a' and the 't'.
5 Move on to the third element '.*'. Since we are at
the end of the string and '.*' can match 0 times,
assign it the empty string.
6 We are done!
Most of the time, all this moving forward and backtracking
happens quickly and searching is fast. There are some
pathological regexps, however, whose execution time expo
nentially grows with the size of the string. A typical
structure that blows up in your face is of the form
/(a|b+)*/;
The problem is the nested indeterminate quantifiers.
There are many different ways of partitioning a string of
length n between the "+" and "*": one repetition with "b+"
of length n, two repetitions with the first "b+" length k
and the second with length n-k, m repetitions whose bits
add up to length n, etc. In fact there are an exponential
number of ways to partition a string as a function of
length. A regexp may get lucky and match early in the
process, but if there is no match, perl will try every
possibility before giving up. So be careful with nested
"*"'s, "{n,m}"'s, and "+"'s. The book Mastering regular
expressions by Jeffrey Friedl gives a wonderful discussion
of this and other efficiency issues.
Building a regexp
At this point, we have all the basic regexp concepts cov
ered, so let's give a more involved example of a regular
expression. We will build a regexp that matches numbers.
The first task in building a regexp is to decide what we
want to match and what we want to exclude. In our case,
we want to match both integers and floating point numbers
and we want to reject any string that isn't a number.
The next task is to break the problem down into smaller
problems that are easily converted into a regexp.
The simplest case is integers. These consist of a
sequence of digits, with an optional sign in front. The
digits we can represent with "\d+" and the sign can be
matched with "[+-]". Thus the integer regexp is
/[+-]?\d+/; # matches integers
A floating point number potentially has a sign, an inte
gral part, a decimal point, a fractional part, and an
exponent. One or more of these parts is optional, so we
need to check out the different possibilities. Floating
point numbers which are in proper form include 123.,
0.345, .34, -1e6, and 25.4E-72. As with integers, the
sign out front is completely optional and can be matched
by "[+-]?". We can see that if there is no exponent,
floating point numbers must have a decimal point, other
wise they are integers. We might be tempted to model
these with "\d*\.\d*", but this would also match just a
single decimal point, which is not a number. So the three
cases of floating point number sans exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
These can be combined into a single regexp with a three-
way alternation:
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
In this alternation, it is important to put "'\d+\.\d+'"
before "'\d+\.'". If "'\d+\.'" were first, the regexp
would happily match that and ignore the fractional part of
the number.
Now consider floating point numbers with exponents. The
key observation here is that both integers and numbers
with decimal points are allowed in front of an exponent.
Then exponents, like the overall sign, are independent of
whether we are matching numbers with or without decimal
points, and can be 'decoupled' from the mantissa. The
overall form of the regexp now becomes clear:
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
The exponent is an "e" or "E", followed by an integer. So
the exponent regexp is
/[eE][+-]?\d+/; # exponent
Putting all the parts together, we get a regexp that
matches numbers:
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
Long regexps like this may impress your friends, but can
be hard to decipher. In complex situations like this, the
"//x" modifier for a match is invaluable. It allows one
to put nearly arbitrary whitespace and comments into a
regexp without affecting their meaning. Using it, we can
rewrite our 'extended' regexp in the more pleasing form
/^
[+-]? # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
If whitespace is mostly irrelevant, how does one include
space characters in an extended regexp? The answer is to
backslash it "'\ '" or put it in a character class
"[ ]" . The same thing goes for pound signs, use "\#" or
"[#]". For instance, Perl allows a space between the sign
and the mantissa/integer, and we could add this to our
regexp as follows:
/^
[+-]?\ * # first, match an optional sign *and space*
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
In this form, it is easier to see a way to simplify the
alternation. Alternatives 1, 2, and 4 all start with
"\d+", so it could be factored out:
/^
[+-]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
or written in the compact form,
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
This is our final regexp. To recap, we built a regexp by
specifying the task in detail,
breaking down the problem into smaller parts,
translating the small parts into regexps,
combining the regexps,
and optimizing the final combined regexp.
These are also the typical steps involved in writing a
computer program. This makes perfect sense, because regu
lar expressions are essentially programs written a little
computer language that specifies patterns.
Using regular expressions in Perl
The last topic of Part 1 briefly covers how regexps are
used in Perl programs. Where do they fit into Perl syn
tax?
We have already introduced the matching operator in its
default "/regexp/" and arbitrary delimiter "m!regexp!"
forms. We have used the binding operator "=~" and its
negation "!~" to test for string matches. Associated with
the matching operator, we have discussed the single line
"//s", multi-line "//m", case-insensitive "//i" and
extended "//x" modifiers.
There are a few more things you might want to know about
matching operators. First, we pointed out earlier that
variables in regexps are substituted before the regexp is
evaluated:
$pattern = 'Seuss';
while (<>) {
print if /$pattern/;
}
This will print any lines containing the word "Seuss". It
is not as efficient as it could be, however, because perl
has to re-evaluate "$pattern" each time through the loop.
If "$pattern" won't be changing over the lifetime of the
script, we can add the "//o" modifier, which directs perl
to only perform variable substitutions once:
#!/usr/bin/perl
# Improved simple_grep
$regexp = shift;
while (<>) {
print if /$regexp/o; # a good deal faster
}
If you change "$pattern" after the first substitution hap
pens, perl will ignore it. If you don't want any substi
tutions at all, use the special delimiter "m''":
$pattern = 'Seuss';
while (<>) {
print if m'$pattern'; # matches '$pattern', not 'Seuss'
}
"m''" acts like single quotes on a regexp; all other "m"
delimiters act like double quotes. If the regexp evalu
ates to the empty string, the regexp in the last success_
ful match is used instead. So we have
"dog" =~ /d/; # 'd' matches
"dogbert =~ //; # this matches the 'd' regexp used before
The final two modifiers "//g" and "//c" concern multiple
matches. The modifier "//g" stands for global matching
and allows the the matching operator to match within a
string as many times as possible. In scalar context, suc
cessive invocations against a string will have `"//g" jump
from match to match, keeping track of position in the
string as it goes along. You can get or set the position
with the "pos()" function.
The use of "//g" is shown in the following example. Sup
pose we have a string that consists of words separated by
spaces. If we know how many words there are in advance,
we could extract the words using groupings:
$x = "cat dog house"; # 3 words
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
# $1 = 'cat'
# $2 = 'dog'
# $3 = 'house'
But what if we had an indeterminate number of words? This
is the sort of task "//g" was made for. To extract all
words, form the simple regexp "(\w+)" and loop over all
matches with "/(\w+)/g":
while ($x =~ /(\w+)/g) {
print "Word is $1, ends at position ", pos $x, "\n";
}
prints
Word is cat, ends at position 3
Word is dog, ends at position 7
Word is house, ends at position 13
A failed match or changing the target string resets the
position. If you don't want the position reset after
failure to match, add the "//c", as in "/regexp/gc". The
current position in the string is associated with the
string, not the regexp. This means that different strings
have different positions and their respective positions
can be set or read independently.
In list context, "//g" returns a list of matched group
ings, or if there are no groupings, a list of matches to
the whole regexp. So if we wanted just the words, we
could use
@words = ($x =~ /(\w+)/g); # matches,
# $word[0] = 'cat'
# $word[1] = 'dog'
# $word[2] = 'house'
Closely associated with the "//g" modifier is the "\G"
anchor. The "\G" anchor matches at the point where the
previous "//g" match left off. "\G" allows us to easily
do context-sensitive matching:
$metric = 1; # use metric units
...
$x = <FILE>; # read in measurement
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
$weight = $1;
if ($metric) { # error checking
print "Units error!" unless $x =~ /\Gkg\./g;
}
else {
print "Units error!" unless $x =~ /\Glbs\./g;
}
$x =~ /\G\s+(widget|sprocket)/g; # continue processing
The combination of "//g" and "\G" allows us to process the
string a bit at a time and use arbitrary Perl logic to
decide what to do next.
"\G" is also invaluable in processing fixed length records
with regexps. Suppose we have a snippet of coding region
DNA, encoded as base pair letters "ATCGTTGAAT..." and we
want to find all the stop codons "TGA". In a coding
region, codons are 3-letter sequences, so we can think of
the DNA snippet as a sequence of 3-letter records. The
naive regexp
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
doesn't work; it may match an "TGA", but there is no guar
antee that the match is aligned with codon boundaries,
e.g., the substring "GTT GAA" gives a match. A better
solution is
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
which prints
Got a TGA stop codon at position 18
Got a TGA stop codon at position 23
Position 18 is good, but position 23 is bogus. What hap
pened?
The answer is that our regexp works well until we get past
the last real match. Then the regexp will fail to match a
synchronized "TGA" and start stepping ahead one character
position at a time, not what we want. The solution is to
use "\G" to anchor the match to the codon alignment:
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
This prints
Got a TGA stop codon at position 18
which is the correct answer. This example illustrates
that it is important not only to match what is desired,
but to reject what is not desired.
search and replace
Regular expressions also play a big role in search and
replace operations in Perl. Search and replace is accom
plished with the "s///" operator. The general form is
"s/regexp/replacement/modifiers", with everything we know
about regexps and modifiers applying in this case as well.
The "replacement" is a Perl double quoted string that
replaces in the string whatever is matched with the "reg
exp". The operator "=~" is also used here to associate a
string with "s///". If matching against "$_", the
"$_ =~" can be dropped. If there is a match, "s///"
returns the number of substitutions made, otherwise it
returns false. Here are a few examples:
$x = "Time to feed the cat!";
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
$more_insistent = 1;
}
$y = "'quoted words'";
$y =~ s/^'(.*)'$/$1/; # strip single quotes,
# $y contains "quoted words"
In the last example, the whole string was matched, but
only the part inside the single quotes was grouped. With
the "s///" operator, the matched variables "$1", "$2",
etc. are immediately available for use in the replacement
expression, so we use "$1" to replace the quoted string
with just what was quoted. With the global modifier,
"s///g" will search and replace all occurrences of the
regexp in the string:
$x = "I batted 4 for 4";
$x =~ s/4/four/; # doesn't do it all:
# $x contains "I batted four for 4"
$x = "I batted 4 for 4";
$x =~ s/4/four/g; # does it all:
# $x contains "I batted four for four"
If you prefer 'regex' over 'regexp' in this tutorial, you
could use the following program to replace it:
% cat > simple_replace
#!/usr/bin/perl
$regexp = shift;
$replacement = shift;
while (<>) {
s/$regexp/$replacement/go;
print;
}
^D
% simple_replace regexp regex perlretut.pod
In "simple_replace" we used the "s///g" modifier to
replace all occurrences of the regexp on each line and the
"s///o" modifier to compile the regexp only once. As with
"simple_grep", both the "print" and the "s/$reg
exp/$replacement/go" use "$_" implicitly.
A modifier available specifically to search and replace is
the "s///e" evaluation modifier. "s///e" wraps an
"eval{...}" around the replacement string and the evalu
ated result is substituted for the matched substring.
"s///e" is useful if you need to do a bit of computation
in the process of replacing text. This example counts
character frequencies in a line:
$x = "Bill the cat";
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
This prints
frequency of ' ' is 2
frequency of 't' is 2
frequency of 'l' is 2
frequency of 'B' is 1
frequency of 'c' is 1
frequency of 'e' is 1
frequency of 'h' is 1
frequency of 'i' is 1
frequency of 'a' is 1
As with the match "m//" operator, "s///" can use other
delimiters, such as "s!!!" and "s{}{}", and even "s{}//".
If single quotes are used "s'''", then the regexp and
replacement are treated as single quoted strings and there
are no substitutions. "s///" in list context returns the
same thing as in scalar context, i.e., the number of
matches.
The split operator
The "split" function can also optionally use a matching
operator "m//" to split a string. "split /regexp/,
string, limit" splits "string" into a list of substrings
and returns that list. The regexp is used to match the
character sequence that the "string" is split with respect
to. The "limit", if present, constrains splitting into no
more than "limit" number of strings. For example, to
split a string into words, use
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
# $word[1] = 'and'
# $word[2] = 'Hobbes'
If the empty regexp "//" is used, the regexp always
matches and the string is split into individual charac
ters. If the regexp has groupings, then list produced
contains the matched substrings from the groupings as
well. For instance,
$x = "/usr/bin/perl";
@dirs = split m!/!, $x; # $dirs[0] = ''
# $dirs[1] = 'usr'
# $dirs[2] = 'bin'
# $dirs[3] = 'perl'
@parts = split m!(/)!, $x; # $parts[0] = ''
# $parts[1] = '/'
# $parts[2] = 'usr'
# $parts[3] = '/'
# $parts[4] = 'bin'
# $parts[5] = '/'
# $parts[6] = 'perl'
Since the first character of $x matched the regexp,
"split" prepended an empty initial element to the list.
If you have read this far, congratulations! You now have
all the basic tools needed to use regular expressions to
solve a wide range of text processing problems. If this
is your first time through the tutorial, why not stop here
and play around with regexps a while... Part 2 concerns
the more esoteric aspects of regular expressions and those
concepts certainly aren't needed right at the start.
Part 2: Power tools
OK, you know the basics of regexps and you want to know
more. If matching regular expressions is analogous to a
walk in the woods, then the tools discussed in Part 1 are
analogous to topo maps and a compass, basic tools we use
all the time. Most of the tools in part 2 are are analo
gous to flare guns and satellite phones. They aren't used
too often on a hike, but when we are stuck, they can be
invaluable.
What follows are the more advanced, less used, or some
times esoteric capabilities of perl regexps. In Part 2,
we will assume you are comfortable with the basics and
concentrate on the new features.
More on characters, strings, and character classes
There are a number of escape sequences and character
classes that we haven't covered yet.
There are several escape sequences that convert characters
or strings between upper and lower case. "\l" and "\u"
convert the next character to lower or upper case, respec
tively:
$x = "perl";
$string =~ /\u$x/; # matches 'Perl' in $string
$x = "M(rs?|s)\\."; # note the double backslash
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
"\L" and "\U" converts a whole substring, delimited by
"\L" or "\U" and "\E", to lower or upper case:
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
$x = "I STILL KEYPUNCH CARDS FOR MY 360"
$x =~ /\Ukeypunch/; # matches punch card string
If there is no "\E", case is converted until the end of
the string. The regexps "\L\u$word" or "\u\L$word" convert
the first character of "$word" to uppercase and the rest
of the characters to lowercase.
Control characters can be escaped with "\c", so that a
control-Z character would be matched with "\cZ". The
escape sequence "\Q"..."\E" quotes, or protects most non-
alphabetic characters. For instance,
$x = "\QThat !^*&%~& cat!";
$x =~ /\Q!^*&%~&\E/; # check for rough language
It does not protect "$" or "@", so that variables can
still be substituted.
With the advent of 5.6.0, perl regexps can handle more
than just the standard ASCII character set. Perl now sup
ports Unicode, a standard for encoding the character sets
from many of the world's written languages. Unicode does
this by allowing characters to be more than one byte wide.
Perl uses the UTF-8 encoding, in which ASCII characters
are still encoded as one byte, but characters greater than
"chr(127)" may be stored as two or more bytes.
What does this mean for regexps? Well, regexp users don't
need to know much about perl's internal representation of
strings. But they do need to know 1) how to represent
Unicode characters in a regexp and 2) when a matching
operation will treat the string to be searched as a
sequence of bytes (the old way) or as a sequence of Uni
code characters (the new way). The answer to 1) is that
Unicode characters greater than "chr(127)" may be repre
sented using the "\x{hex}" notation, with "hex" a hexadec
imal integer:
use utf8; # We will be doing Unicode processing
/\x{263a}/; # match a Unicode smiley face :)
Unicode characters in the range of 128-255 use two hex
adecimal digits with braces: "\x{ab}". Note that this is
different than "\xab", which is just a hexadecimal byte
with no Unicode significance.
Figuring out the hexadecimal sequence of a Unicode charac
ter you want or deciphering someone else's hexadecimal
Unicode regexp is about as much fun as programming in
machine code. So another way to specify Unicode charac
ters is to use the named character escape sequence
"\N{name}". "name" is a name for the Unicode character,
as specified in the Unicode standard. For instance, if we
wanted to represent or match the astrological sign for the
planet Mercury, we could use
use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use short names or restrict names to a cer
tain alphabet:
use utf8; # We will be doing Unicode processing
use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
use charnames ":short";
print "\N{greek:Sigma} is an upper-case sigma.\n";
use charnames qw(greek);
print "\N{sigma} is Greek sigma\n";
A list of full names is found in the file Names.txt in the
lib/perl5/5.6.0/unicode directory.
The answer to requirement 2), as of 5.6.0, is that if a
regexp contains Unicode characters, the string is searched
as a sequence of Unicode characters. Otherwise, the
string is searched as a sequence of bytes. If the string
is being searched as a sequence of Unicode characters, but
matching a single byte is required, we can use the "\C"
escape sequence. "\C" is a character class akin to "."
except that it matches any byte 0-255. So
use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "a";
$x =~ /\C/; # matches 'a', eats one byte
$x = "";
$x =~ /\C/; # doesn't match, no bytes to match
$x = "\N{MERCURY}"; # two-byte Unicode character
$x =~ /\C/; # matches, but dangerous!
The last regexp matches, but is dangerous because the
string character position is no longer synchronized to the
string byte position. This generates the warning 'Mal
formed UTF-8 character'. "\C" is best used for matching
the binary data in strings with binary data intermixed
with Unicode characters.
Let us now discuss the rest of the character classes.
Just as with Unicode characters, there are named Unicode
character classes represented by the "\p{name}" escape
sequence. Closely associated is the "\P{name}" character
class, which is the negation of the "\p{name}" class. For
example, to match lower and uppercase characters,
use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
Here is the association between some Perl named classes
and the traditional Unicode classes:
Perl class name Unicode class name or regular expression
IsAlpha /^[LM]/
IsAlnum /^[LMN]/
IsASCII $code <= 127
IsCntrl /^C/
IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
IsDigit Nd
IsGraph /^([LMNPS]|Co)/
IsLower Ll
IsPrint /^([LMNPS]|Co|Zs)/
IsPunct /^P/
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D)$/
IsUpper /^L[ut]/
IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
You can also use the official Unicode class names with the
"\p" and "\P", like "\p{L}" for Unicode 'letters', or
"\p{Lu}" for uppercase letters, or "\P{Nd}" for non-dig
its. If a "name" is just one letter, the braces can be
dropped. For instance, "\pM" is the character class of
Unicode 'marks'.
"\X" is an abbreviation for a character class sequence
that includes the Unicode 'combining character sequences'.
A 'combining character sequence' is a base character fol
lowed by any number of combining characters. An example
of a combining character is an accent. Using the Unicode
full names, e.g., "A + COMBINING RING" is a combining
character sequence with base character "A" and combining
character "COMBINING RING" , which translates in Danish to
A with the circle atop it, as in the word Angstrom. "\X"
is equivalent to "\PM\pM*}", i.e., a non-mark followed by
one or more marks.
As if all those classes weren't enough, Perl also defines
POSIX style character classes. These have the form
"[:name:]", with "name" the name of the POSIX class. The
POSIX classes are "alpha", "alnum", "ascii", "cntrl",
"digit", "graph", "lower", "print", "punct", "space",
"upper", and "xdigit", and two extensions, "word" (a Perl
extension to match "\w"), and "blank" (a GNU extension).
If "utf8" is being used, then these classes are defined
the same as their corresponding perl Unicode classes:
"[:upper:]" is the same as "\p{IsUpper}", etc. The POSIX
character classes, however, don't require using "utf8".
The "[:digit:]", "[:word:]", and "[:space:]" correspond to
the familiar "\d", "\w", and "\s" character classes. To
negate a POSIX class, put a "^" in front of the name, so
that, e.g., "[:^digit:]" corresponds to "\D" and under
"utf8", "\P{IsDigit}". The Unicode and POSIX character
classes can be used just like "\d", both inside and out
side of character classes:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
/^=item\s[:digit:]/; # match '=item',
# followed by a space and a digit
use utf8;
use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digit
Whew! That is all the rest of the characters and character
classes.
Compiling and saving regular expressions
In Part 1 we discussed the "//o" modifier, which compiles
a regexp just once. This suggests that a compiled regexp
is some data structure that can be stored once and used
again and again. The regexp quote "qr//" does exactly
that: "qr/string/" compiles the "string" as a regexp and
transforms the result into a form that can be assigned to
a variable:
$reg = qr/foo+bar?/; # reg contains a compiled regexp
Then "$reg" can be used as a regexp:
$x = "fooooba";
$x =~ $reg; # matches, just like /foo+bar?/
$x =~ /$reg/; # same thing, alternate form
"$reg" can also be interpolated into a larger regexp:
$x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use
different delimiters, e.g., "qr!!", "qr{}" and "qr~~".
The single quote delimiters "qr''" prevent any interpola
tion from taking place.
Pre-compiled regexps are useful for creating dynamic
matches that don't need to be recompiled each time they
are encountered. Using pre-compiled regexps,
"simple_grep" program can be expanded into a program that
matches multiple patterns:
% cat > multi_grep
#!/usr/bin/perl
# multi_grep - match any of <number> regexps
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
foreach $pattern (@compiled) {
if ($line =~ /$pattern/) {
print $line;
last; # we matched, so move onto the next line
}
}
}
^D
% multi_grep 2 last for multi_grep
$regexp[$_] = shift foreach (0..$number-1);
foreach $pattern (@compiled) {
last;
Storing pre-compiled regexps in an array "@compiled"
allows us to simply loop through the regexps without any
recompilation, thus gaining flexibility without sacrific
ing speed.
Embedding comments and modifiers in a regular expression
Starting with this section, we will be discussing Perl's
set of extended patterns. These are extensions to the
traditional regular expression syntax that provide power
ful new tools for pattern matching. We have already seen
extensions in the form of the minimal matching constructs
"??", "*?", "+?", "{n,m}?", and "{n,}?". The rest of the
extensions below have the form "(?char...)", where the
"char" is a character that determines the type of exten
sion.
The first extension is an embedded comment "(?#text)".
This embeds a comment into the regular expression without
affecting its meaning. The comment should not have any
closing parentheses in the text. An example is
/(?# Match an integer:)[+-]?\d+/;
This style of commenting has been largely superseded by
the raw, freeform commenting that is allowed with the
"//x" modifier.
The modifiers "//i", "//m", "//s", and "//x" can also
embedded in a regexp using "(?i)", "(?m)", "(?s)", and
"(?x)". For instance,
/(?i)yes/; # match 'yes' case insensitively
/yes/i; # same thing
/(?x)( # freeform version of an integer regexp
[+-]? # match an optional sign
\d+ # match a sequence of digits
)
/x;
Embedded modifiers can have two important advantages over
the usual modifiers. Embedded modifiers allow a custom
set of modifiers to each regexp pattern. This is great
for matching an array of regexps that must have different
modifiers:
$pattern[0] = '(?i)doctor';
$pattern[1] = 'Johnson';
...
while (<>) {
foreach $patt (@pattern) {
print if /$patt/;
}
}
The second advantage is that embedded modifiers only
affect the regexp inside the group the embedded modifier
is contained in. So grouping can be used to localize the
modifier's effects:
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
Embedded modifiers can also turn off any modifiers already
present by using, e.g., "(?-i)". Modifiers can also be
combined into a single expression, e.g., "(?s-i)" turns on
single line mode and turns off case insensitivity.
Non-capturing groupings
We noted in Part 1 that groupings "()" had two distinct
functions: 1) group regexp elements together as a single
unit, and 2) extract, or capture, substrings that matched
the regexp in the grouping. Non-capturing groupings,
denoted by "(?:regexp)", allow the regexp to be treated as
a single unit, but don't extract substrings or set match
ing variables "$1", etc. Both capturing and non-capturing
groupings are allowed to co-exist in the same regexp.
Because there is no extraction, non-capturing groupings
are faster than capturing groupings. Non-capturing group
ings are also handy for choosing exactly which parts of a
regexp are to be extracted to matching variables:
# match a number, $1-$4 are set, but we only want $1
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
# match a number faster , only $1 is set
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
# match a number, get $1 = whole number, $2 = exponent
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
Non-capturing groupings are also useful for removing nui
sance elements gathered from a split operation:
$x = '12a34b5';
@num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
@num = split /(?:a|b)/, $x; # @num = ('12','34','5')
Non-capturing groupings may also have embedded modifiers:
"(?i-m:regexp)" is a non-capturing grouping that matches
"regexp" case insensitively and turns off multi-line mode.
Looking ahead and looking behind
This section concerns the lookahead and lookbehind asser
tions. First, a little background.
In Perl regular expressions, most regexp elements 'eat up'
a certain amount of string when they match. For instance,
the regexp element "[abc}]" eats up one character of the
string when it matches, in the sense that perl moves to
the next character position in the string after the match.
There are some elements, however, that don't eat up char
acters (advance the character position) if they match.
The examples we have seen so far are the anchors. The
anchor "^" matches the beginning of the line, but doesn't
eat any characters. Similarly, the word boundary anchor
"\b" matches, e.g., if the character to the left is a word
character and the character to the right is a non-word
character, but it doesn't eat up any characters itself.
Anchors are examples of 'zero-width assertions'. Zero-
width, because they consume no characters, and assertions,
because they test some property of the string. In the
context of our walk in the woods analogy to regexp match
ing, most regexp elements move us along a trail, but
anchors have us stop a moment and check our surroundings.
If the local environment checks out, we can proceed for
ward. But if the local environment doesn't satisfy us, we
must backtrack.
Checking the environment entails either looking ahead on
the trail, looking behind, or both. "^" looks behind, to
see that there are no characters before. "$" looks ahead,
to see that there are no characters after. "\b" looks
both ahead and behind, to see if the characters on either
side differ in their 'word'-ness.
The lookahead and lookbehind assertions are generaliza
tions of the anchor concept. Lookahead and lookbehind are
zero-width assertions that let us specify which characters
we want to test for. The lookahead assertion is denoted
by "(?=regexp)" and the lookbehind assertion is denoted by
"(?<=fixed-regexp)". Some examples are
$x = "I catch the housecat 'Tom-cat' with catnip";
$x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
# middle of $x
Note that the parentheses in "(?=regexp)" and "(?<=reg
exp)" are non-capturing, since these are zero-width asser
tions. Thus in the second regexp, the substrings captured
are those of the whole regexp itself. Lookahead "(?=reg
exp)" can match arbitrary regexps, but lookbehind
"(?<=fixed-regexp)" only works for regexps of fixed width,
i.e., a fixed number of characters long. Thus
"(?<=(ab|bc))" is fine, but "(?<=(ab)*)" is not. The
negated versions of the lookahead and lookbehind asser
tions are denoted by "(?!regexp)" and "(?<!fixed-regexp)"
respectively. They evaluate true if the regexps do not
match:
$x = "foobar";
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
Using independent subexpressions to prevent backtracking
The last few extended patterns in this tutorial are exper
imental as of 5.6.0. Play with them, use them in some
code, but don't rely on them just yet for production code.
Independent subexpressions are regular expressions, in
the context of a larger regular expression, that function
independently of the larger regular expression. That is,
they consume as much or as little of the string as they
wish without regard for the ability of the larger regexp
to match. Independent subexpressions are represented by
"(?>regexp)". We can illustrate their behavior by first
considering an ordinary regexp:
$x = "ab";
$x =~ /a*ab/; # matches
This obviously matches, but in the process of matching,
the subexpression "a*" first grabbed the "a". Doing so,
however, wouldn't allow the whole regexp to match, so
after backtracking, "a*" eventually gave back the "a" and
matched the empty string. Here, what "a*" matched was
dependent on what the rest of the regexp matched.
Contrast that with an independent subexpression:
$x =~ /(?>a*)ab/; # doesn't match!
The independent subexpression "(?>a*)" doesn't care about
the rest of the regexp, so it sees an "a" and grabs it.
Then the rest of the regexp "ab" cannot match. Because
"(?>a*)" is independent, there is no backtracking and and
the independent subexpression does not give up its "a".
Thus the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
$x = "ab";
$x =~ /a*/g; # matches, eats an 'a'
$x =~ /\Gab/g; # doesn't match, no 'a' available
Here "//g" and "\G" create a 'tag team' handoff of the
string from one regexp to the other. Regexps with an
independent subexpression are much like this, with a hand
off of the string to the independent subexpression, and a
handoff of the string back to the enclosing regexp.
The ability of an independent subexpression to prevent
backtracking can be quite useful. Suppose we want to
match a non-empty string enclosed in parentheses up to two
levels deep. Then the following regexp matches:
$x = "abc(de(fg)h"; # unbalanced parentheses
$x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
The regexp matches an open parenthesis, one or more copies
of an alternation, and a close parenthesis. The alterna
tion is two-way, with the first alternative "[^()]+"
matching a substring with no parentheses and the second
alternative "\([^()]*\)" matching a substring delimited
by parentheses. The problem with this regexp is that it
is pathological: it has nested indeterminate quantifiers
of the form "(a+|b)+". We discussed in Part 1 how nested
quantifiers like this could take an exponentially long
time to execute if there was no match possible. To
prevent the exponential blowup, we need to prevent useless
backtracking at some point. This can be done by enclosing
the inner quantifier as an independent subexpression:
$x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
Here, "(?>[^()]+)" breaks the degeneracy of string parti
tioning by gobbling up as much of the string as possible
and keeping it. Then match failures fail much more
quickly.
Conditional expressions
A conditional expression is a form of if-then-else state
ment that allows one to choose which patterns are to be
matched, based on some condition. There are two types of
conditional expression: "(?(condition)yes-regexp)" and
"(?(condition)yes-regexp|no-regexp)". "(?(condi
tion)yes-regexp)" is like an "'if () {}'" statement in
Perl. If the "condition" is true, the "yes-regexp" will
be matched. If the "condition" is false, the "yes-regexp"
will be skipped and perl will move onto the next regexp
element. The second form is like an "'if () {} else {}'"
statement in Perl. If the "condition" is true, the
"yes-regexp" will be matched, otherwise the "no-regexp"
will be matched.
The "condition" can have two forms. The first form is
simply an integer in parentheses "(integer)". It is true
if the corresponding backreference "\integer" matched ear
lier in the regexp. The second form is a bare zero width
assertion "(?...)", either a lookahead, a lookbehind, or a
code assertion (discussed in the next section).
The integer form of the "condition" allows us to choose,
with more flexibility, what to match based on what matched
earlier in the regexp. This searches for words of the form
""$x$x"" or ""$x$y$y$x"":
% simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
beriberi
coco
couscous
deed
...
toot
toto
tutu
The lookbehind "condition" allows, along with backrefer
ences, an earlier part of the match to influence a later
part of the match. For instance,
/[ATGC]+(?(?<=AA)G|C)$/;
matches a DNA sequence such that it either ends in "AAG",
or some other base pair combination and "C". Note that
the form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for
the lookahead, lookbehind or code assertions, the paren
theses around the conditional are not needed.
A bit of magic: executing Perl code in a regular expres
sion
Normally, regexps are a part of Perl expressions.
Code evaluation expressions turn that around by allowing
arbitrary Perl code to be a part of of a regexp. A code
evaluation expression is denoted "(?{code})", with "code"
a string of Perl statements.
Code expressions are zero-width assertions, and the value
they return depends on their environment. There are two
possibilities: either the code expression is used as a
conditional in a conditional expression "(?(condi
tion)...)", or it is not. If the code expression is a
conditional, the code is evaluated and the result (i.e.,
the result of the last statement) is used to determine
truth or falsehood. If the code expression is not used as
a conditional, the assertion always evaluates true and the
result is put into the special variable "$^R". The vari
able "$^R" can then be used in code expressions later in
the regexp. Here are some silly examples:
$x = "abcdef";
$x =~ /abc(?{print "Hi Mom!";})def/; # matches,
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'
Pay careful attention to the next example:
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
# but why not?
At first glance, you'd think that it shouldn't print,
because obviously the "ddd" isn't going to match the tar
get string. But look at this example:
$x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
# but _does_ print
Hmm. What happened here? If you've been following along,
you know that the above pattern should be effectively the
same as the last one -- enclosing the d in a character
class isn't going to change what it matches. So why does
the first not print while the second one does?
The answer lies in the optimizations the REx engine makes.
In the first case, all the engine sees are plain old char
acters (aside from the "?{}" construct). It's smart enough
to realize that the string 'ddd' doesn't occur in our tar
get string before actually running the pattern through.
But in the second case, we've tricked it into thinking
that our pattern is more complicated than it is. It takes
a look, sees our character class, and decides that it will
have to actually run the pattern to determine whether or
not it matches, and in the process of running it hits the
print statement before it discovers that we don't have a
match.
To take a closer look at how the engine does optimiza
tions, see the section the section on "Pragmas and debug
ging" below.
More fun with "?{}":
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
# prints '1'
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
# prints '1'
The bit of magic mentioned in the section title occurs
when the regexp backtracks in the process of searching for
a match. If the regexp backtracks over a code expression
and if the variables used within are localized using
"local", the changes in the variables produced by the code
expression are undone! Thus, if we wanted to count how
many times a character got matched inside a group, we
could use, e.g.,
$x = "aaaa";
$count = 0; # initialize 'a' count
$c = "bob"; # test if $c gets clobbered
$x =~ /(?{local $c = 0;}) # initialize count
( a # match 'a'
(?{local $c = $c + 1;}) # increment count
)* # do this any number of times,
aa # but match 'aa' at the end
(?{$count = $c;}) # copy local $c var into $count
/x;
print "'a' count is $count, \$c variable is '$c'\n";
This prints
'a' count is 2, $c variable is 'bob'
If we replace the " (?{local $c = $c + 1;})" with
" (?{$c = $c + 1;})" , the variable changes are not undone
during backtracking, and we get
'a' count is 4, $c variable is 'bob'
Note that only localized variable changes are undone.
Other side effects of code expression execution are perma
nent. Thus
$x = "aaaa";
$x =~ /(a(?{print "Yow\n";}))*aa/;
produces
Yow
Yow
Yow
Yow
The result "$^R" is automatically localized, so that it
will behave properly in the presence of backtracking.
This example uses a code expression in a conditional to
match the article 'the' in either English or German:
$lang = 'DE'; # use German
...
$text = "das";
print "matched\n"
if $text =~ /(?(?{
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
(die|das|der) # else, match 'die|das|der'
)
/xi;
Note that the syntax here is "(?(?{...})yes-regexp|no-reg
exp)", not "(?((?{...}))yes-regexp|no-regexp)". In other
words, in the case of a code expression, we don't need the
extra parentheses around the conditional.
If you try to use code expressions with interpolating
variables, perl may surprise you:
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
/foo(?{ 1 })$bar/; # compile error!
/foo${pat}bar/; # compile error!
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles ok
If a regexp has (1) code expressions and interpolating
variables,or (2) a variable that interpolates a code
expression, perl treats the regexp as an error. If the
code expression is precompiled into a variable, however,
interpolating is ok. The question is, why is this an
error?
The reason is that variable interpolation and code expres
sions together pose a security risk. The combination is
dangerous because many programmers who write search
engines often take user input and plug it directly into a
regexp:
$regexp = <>; # read user-supplied regexp
$chomp $regexp; # get rid of possible newline
$text =~ /$regexp/; # search $text for the $regexp
If the "$regexp" variable contains a code expression, the
user could then execute arbitrary Perl code. For
instance, some joker could search for "sys
tem('rm -rf *');" to erase your files. In this sense,
the combination of interpolation and code expressions
taints your regexp. So by default, using both interpola
tion and code expressions in the same regexp is not
allowed. If you're not concerned about malicious users,
it is possible to bypass this security check by invoking
"use re 'eval'" :
use re 'eval'; # throw caution out the door
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ 1 })$bar/; # compiles ok
/foo${pat}bar/; # compiles ok
Another form of code expression is the pat
tern code expression . The pattern code expression is
like a regular code expression, except that the result of
the code evaluation is treated as a regular expression and
matched immediately. A simple example is
$length = 5;
$char = 'a';
$x = 'aaaaabb';
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
This final example contains both ordinary and pattern code
expressions. It detects if a binary string
"1101010010001..." has a Fibonacci spacing 0,1,1,2,3,5,...
of the "1"'s:
$s0 = 0; $s1 = 1; # initial conditions
$x = "1101010010001000001";
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
(
(??{'0' x $s0}) # match $s0 of '0'
1 # and then a '1'
(?{
$largest = $s0; # largest seq so far
$s2 = $s1 + $s0; # compute next term
$s0 = $s1; # in Fibonacci sequence
$s1 = $s2;
})
)+ # repeat as needed
$ # that is all there is
/x;
print "Largest sequence matched was $largest\n";
This prints
It is a Fibonacci sequence
Largest sequence matched was 5
Ha! Try that with your garden variety regexp package...
Note that the variables "$s0" and "$s1" are not substi
tuted when the regexp is compiled, as happens for ordinary
variables outside a code expression. Rather, the code
expressions are evaluated when perl encounters them during
the search for a match.
The regexp without the "//x" modifier is
/^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
and is a great start on an Obfuscated Perl entry :-) When
working with code and conditional expressions, the
extended form of regexps is almost necessary in creating
and debugging regexps.
Pragmas and debugging
Speaking of debugging, there are several pragmas available
to control and debug regexps in Perl. We have already
encountered one pragma in the previous section,
"use re 'eval';" , that allows variable interpolation and
code expressions to coexist in a regexp. The other prag
mas are
use re 'taint';
$tainted = <>;
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
The "taint" pragma causes any substrings from a match with
a tainted variable to be tainted as well. This is not
normally the case, as regexps are often used to extract
the safe bits from a tainted variable. Use "taint" when
you are not extracting safe bits, but are performing some
other processing. Both "taint" and "eval" pragmas are
lexically scoped, which means they are in effect only
until the end of the block enclosing the pragmas.
use re 'debug';
/^(.*)$/s; # output debugging info
use re 'debugcolor';
/^(.*)$/s; # output debugging info in living color
The global "debug" and "debugcolor" pragmas allow one to
get detailed debugging info about regexp compilation and
execution. "debugcolor" is the same as debug, except the
debugging information is displayed in color on terminals
that can display termcap color sequences. Here is example
output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
If you have gotten this far into the tutorial, you can
probably guess what the different parts of the debugging
output tell you. The first part
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
describes the compilation stage. "STAR(4)" means that
there is a starred object, in this case "'a'", and if it
matches, goto line 4, i.e., "PLUS(7)". The middle lines
describe some heuristics and optimizations performed
before a match:
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Then the match is executed and the remaining lines
describe the process:
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
Each step is of the form "n <x> <y>" , with "<x>" the part
of the string matched and "<y>" the part not yet matched.
The "| 1: STAR" says that perl is at line number 1 n the
compilation list above. See the Debugging regular expres
sions entry in the perldebguts manpage for much more
detail.
An alternative method of debugging regexps is to embed
"print" statements within the regexp. This provides a
blow-by-blow account of the backtracking in an alterna
tion:
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
t(?{print "t1\n";})
h(?{print "h1\n";})
i(?{print "i1\n";})
s(?{print "s1\n";})
|
t(?{print "t2\n";})
h(?{print "h2\n";})
a(?{print "a2\n";})
t(?{print "t2\n";})
(?{print "Done at position ", pos, "\n";})
@x;
prints
Start at position 0
t1
h1
t2
h2
a2
t2
Done at position 4
BUGS
Code expressions, conditional expressions, and independent
expressions are experimental. Don't use them in produc
tion code. Yet.
SEE ALSO
This is just a tutorial. For the full story on perl
regular expressions, see the the perlre manpage regular
expressions reference page.
For more information on the matching "m//" and substitu
tion "s///" operators, see the Regexp Quote-Like Operators
entry in the perlop manpage. For information on the
"split" operation, see the split entry in the perlfunc
manpage.
For an excellent all-around resource on the care and feed
ing of regular expressions, see the book Mastering Regular
Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
1556592-257-3).
AUTHOR AND COPYRIGHT
Copyright (c) 2000 Mark Kvale All rights reserved.
This document may be distributed under the same terms as
Perl itself.
Acknowledgments
The inspiration for the stop codon DNA example came from
the ZIP code example in chapter 7 of Mastering Regular
Expressions.
The author would like to thank Jeff Pinyan, Andrew John
son, Peter Haworth, Ronald J Kimball, and Joe Smith for
all their helpful comments.
2001-03-18 perl v5.6.1 PERLRETUT(1)
